circad | circRNAs associated with diseases

hsa_circ_0006633
Gene	FGGY	Organism	Human
Genome Locus	chr1:59805629-59844509:+	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	28656881
Experimental Method
Sample Type	Tissues	Comparison	96 gastric cancer tissues and their adjacent non-tumorous tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTCCCGGACTTCTTATCGTGG Reverse CGATGGTCCAGCCACATGAT	Statistics	Fold Change : Downregulated pvalue : p<0.001
Citation
Lu, R, Shao, Y, Ye, G, Xiao, B, Guo, J (2017). Low expression of hsa_circ_0006633 in human gastric cancer and its clinical significances. Tumour Biol., 39, 6:1010428317704175.